bioinformatics-list September 2016

bioinformatics-list@list.utas.edu.au

2 participants
8 discussions

FW: High profile seminar - Monday 12-1 pm
by Dorothy Steane 29 Sep '16

29 Sep '16

Hi everyone, In case any of you haven't already received this email from Erik, I urge you to go and listen to Jenny Graves on Monday, if you possibly can. She always speaks well and is an inspiration for everyone ... but especially women in science (god knows how she managed such a brilliant career, with kids and everything! She once said that you have to work bloody hard for 10 years per kid ... i.e., if you have four kids you have to work bloody hard for forty years!). She has been doing molecular genetics forever, since the days when we thought a restriction digest was pretty damn cool and PCR hadn't been invented ... and she's still going strong! Cheers, Dot. From: Biological Sciences Sent: Thursday, 29 September 2016 12:10 PM Subject: High profile seminar - Monday 12-1 pm Hi all On Monday, we are privileged to have a seminar by Distinguished Professor Jenny Marshall Graves AO, FAA from Latrobe University. Her talk will be at 12 pm in Lecture Theatre 2. The title is "Sex, genes and human evolution" (see attached abstract). Professor Graves has a multitude of title, Distinguished Professor at Latrobe, Professor Emeritus, ANU; Thinker in Residence, University of Canberra and , Professorial Fellow at the University of Melbourne, Fellow of the Australian Academy of Sciences and for good measure, Order of Australia. She has published seminal Nature and Science papers (with a H-Index of 55). Her >20 papers in Nature and Science include key work on Devils, Platypus, Humans, and to make it even more special, reptiles. See further details below Please spread the word around your network. Erik Brief Bio (from her website: http://www.latrobe.edu.au/she/staff/profile?uname=jgraves) Jenny Graves made seminal contributions to the understanding of mammalian genome organization and evolution, exploiting the genetic diversity of Australia's unique animals as a source of genetic variation to study highly conserved genetic structures and processes. Her studies of the chromosomes and genes of kangaroos and platypus, devils (Tasmanian) and dragons (lizards) has shed light on the organisation, function and evolution of mammalian genomes, and led to influential new theories of the origin and evolution of human sex chromosomes and sex determining genes. She is (in)famous for her prediction that the human Y chromosome is disappearing. She made critical discoveries that the epigenetic silencing of mammalian X chromosomes occurred by transcriptional inhibition, and is mediated by DNA methylation. Jenny has been involved in international comparative gene mapping and sequencing projects since the mid-1980s, promulgating the value of comparative genomics and the special value of including distantly related species. She initiated projects to sequence the genomes of marsupials and the platypus, and was Foundation Director of the ARC Centre of Excellence in Kangaroo Genomics. Jenny received a BSc Hons and MSc from the University of Adelaide for work on the epigenetic silencing of one X chromosome in female marsupials. She then used a Fulbright Travel Grant to do a PhD in molecular biology at the University of California, Berkeley, which she received in 1971 for her work on the control of DNA synthesis in mammalian cells. In 1971, she returned to Australia as a lecturer in Genetics at La Trobe University, becoming a Professor in 1991. In 2001 she moved to the Research School of Biological Sciences, Australian National University as head of the Comparative Genomics Research Unit and Director of the ARC Centre for Excellence in Kangaroo Genomics. She has recently returned to Melbourne as Distinguished Professor at La Trobe University, but also holds honorary positions at ANU, the University of Canberra and the University of Melbourne. Jenny has published more than 420 scientific works, including 4 books. She was elected a Fellow of the Australian Academy of Science in 1999 and served on the Academy Executive, first as Foreign Secretary, then as Secretary for Education. She is 2006 L'Oreal-UNESCO Laureate, and has received many awards for her work, including the MacFarlane Burnet Medal for research in biology, and an AO. [Picture3] University of Tasmania Electronic Communications Policy (December, 2014). This email is confidential, and is for the intended recipient only. Access, disclosure, copying, distribution, or reliance on any of it by anyone outside the intended recipient organisation is prohibited and may be a criminal offence. Please delete if obtained in error and email confirmation to the sender. The views expressed in this email are not necessarily the views of the University of Tasmania, unless clearly intended otherwise.

1 0

In case you didn't get it from the blog - Fwd: [New post] BAM! Bird Acoustic Monitoring
by Michael Charleston 27 Sep '16

27 Sep '16

Michael Charleston Associate Professor in Bioinformatics School of Physical Sciences University of Tasmania AUSTRALIA phone: +61 3 6226 2444 Begin forwarded message: From: Bioinformatics in Tasmania <comment-reply(a)wordpress.com<mailto:comment-reply@wordpress.com>> Subject: [New post] BAM! Bird Acoustic Monitoring Date: 27 September 2016 at 12:59:05 PM AEST Reply-To: Bioinformatics in Tasmania <comment+zydz-3t1u732j0vc57twr8(a)comment.wordpress.com<mailto:comment+zydz-3t1u732j0vc57twr8@comment.wordpress.com>> Respond to this post by replying above this line New post on Bioinformatics in Tasmania [http://s0.wp.com/i/emails/blavatar.png] [http://0.gravatar.com/avatar/60993ebeabab99e5012bc8ac9c8ebf3c?s=50&d=identi…]<https://bioinformaticstasmania.wordpress.com/author/mcharleston/> BAM! Bird Acoustic Monitoring<https://bioinformaticstasmania.wordpress.com/2016/09/27/bam-bird-acoustic-m…> by Michael Charleston<https://bioinformaticstasmania.wordpress.com/author/mcharleston/> Scott Whitemore<mailto:scott.whitemore@utas.edu.au> has kindly agreed to give us a seminar THIS Thursday (29th September) about his current work on using computational and statistical methods to identify birds from their calls. 4pm, usual place! (Lecture Theatre 2, Maths & Physics building.) Michael Charleston<https://bioinformaticstasmania.wordpress.com/author/mcharleston/> | 2016-09-27 at 12:59 pm | Categories: bioinformatics<https://bioinformaticstasmania.wordpress.com/?cat=60424> | URL: http://wp.me/p6bMKq-c6 Comment<https://bioinformaticstasmania.wordpress.com/2016/09/27/bam-bird-acoustic-m…> See all comments<https://bioinformaticstasmania.wordpress.com/2016/09/27/bam-bird-acoustic-m…> Like<https://bioinformaticstasmania.wordpress.com/2016/09/27/bam-bird-acoustic-m…> Unsubscribe<https://subscribe.wordpress.com/?key=fdc9303f3833fab447d3e952e039a780&email…> to no longer receive posts from Bioinformatics in Tasmania. Change your email settings at Manage Subscriptions<https://subscribe.wordpress.com/?key=fdc9303f3833fab447d3e952e039a780&email…>. Trouble clicking? Copy and paste this URL into your browser: https://bioinformaticstasmania.wordpress.com/2016/09/27/bam-bird-acoustic-m… Thanks for flying with [https://s0.wp.com/i/emails/blavatar-default.png] WordPress.com<https://wordpress.com/> University of Tasmania Electronic Communications Policy (December, 2014). This email is confidential, and is for the intended recipient only. Access, disclosure, copying, distribution, or reliance on any of it by anyone outside the intended recipient organisation is prohibited and may be a criminal offence. Please delete if obtained in error and email confirmation to the sender. The views expressed in this email are not necessarily the views of the University of Tasmania, unless clearly intended otherwise.

1 0

KMA712 / Introduction to Bioinformatics
by Michael Charleston 27 Sep '16

27 Sep '16

Dear all, I’ve had approved after much administrative pain a change of the delivery of KMA712 from the Short Sharp Shock approach (a.k.a. firehose or “I Know Kung Fu” / The Matrix) to a MUCH more digestible pace; as a through-the-semester unit with lectures (available online as well as live) and labs where you get to do stuff. It will run in Semester next year on the Sandy Bay Campus and I’ll record the lectures so it should be functionally accessible remotely. If you’re interested in this unit, please let me know! If you know someone who might be interested, let *them* know. CIRCULATE WIDELY! Where it says "It is intended that the unit will move to a more blended mode, allowing the unit to run through Semester 1 using mainly on-line delivery. This is to be confirmed for 2017.“ on the website at http://www.utas.edu.au/courses/set/units/kma712-bioinformatics, that has been confirmed. Let me know if you want to know more. Best wishes Mike Please check out Michael Charleston Associate Professor in Bioinformatics School of Physical Sciences University of Tasmania AUSTRALIA phone: +61 3 6226 2444 University of Tasmania Electronic Communications Policy (December, 2014). This email is confidential, and is for the intended recipient only. Access, disclosure, copying, distribution, or reliance on any of it by anyone outside the intended recipient organisation is prohibited and may be a criminal offence. Please delete if obtained in error and email confirmation to the sender. The views expressed in this email are not necessarily the views of the University of Tasmania, unless clearly intended otherwise.

1 0

How to find the perfect match
by Michael Charleston 20 Sep '16

20 Sep '16

Are you troubled by not finding the perfect match? Well, having discussed sequence alignment for the last couple of weeks I thought this would be a good time to talk about how finding a perfect match works. That is, how to find a sequence, like this one TATCACT … inside another (database of) other sequence(s): TTAGCTACTTACTAGCGTCATATCACTTATCTAGCATTCATCTGTACGTATCTAC TTAGCTACTTACTAGCGTCATATCCCTTATCTAGCATTCATCTGTACGTATCTAC TTATCGACTATCATGACTATAGCTATCTGAGGTCAGTCGTTACTATATTATTATCTGCGCGCGATTACGTAGCTACTTACTAGCGTCATATCCCTTATCTAGCATTCATCTGTACGTATCTAC … and of course you know you just use Command-F. But how do we find a matching string that’s 25 bases long, in a list of 100,000,000,000 bases? And then, how do you find all of them? That’s the question that we have to be able to answer, if we want to, say, do BLAST. Given that sequence alignment is essentially a bit slow (it’s O(n^2): takes roughly an amount of time proportional to the square of the sequence lengths), we need to use a fast method to find matching strings, that doesn’t have to use alignment. I’ll talk about these things on Thursday of this week: * finding the perfect match * hashing * BLAST See you then! (I hope…) Cheers Mike Michael Charleston Associate Professor in Bioinformatics School of Physical Sciences University of Tasmania AUSTRALIA phone: +61 3 6226 2444 University of Tasmania Electronic Communications Policy (December, 2014). This email is confidential, and is for the intended recipient only. Access, disclosure, copying, distribution, or reliance on any of it by anyone outside the intended recipient organisation is prohibited and may be a criminal offence. Please delete if obtained in error and email confirmation to the sender. The views expressed in this email are not necessarily the views of the University of Tasmania, unless clearly intended otherwise.

1 0

Sequence Alignment
by Michael Charleston 08 Sep '16

08 Sep '16

Today in Bioinformatics we talked about how sequence alignment works for two sequences. It uses dynamic programming to guarantee that subject to the scoring method we use (and which cannot get particularly complex), we can find the alignment or alignments that is (are) of the best possible total score. NEXT WEEK – that is, on the 15th of September, I will carry on and talk about multiple sequence alignment. So this is an additional session. It was generally agreed that this would be a welcome continuation, but you should to course feel free to drop in to learn how multiple sequence alignment is done. There will be plenty of opportunity to ask questions. If you’ve always wondered whether you should align by hand or by using Muscle, T-Coffee, or some method chosen for you that you just go along with, that would be a good time to ask! If you’d like to know about BLAST, this would also be a good time. Cheers for now! Mike Michael Charleston Associate Professor in Bioinformatics School of Physical Sciences University of Tasmania AUSTRALIA phone: +61 3 6226 2444 University of Tasmania Electronic Communications Policy (December, 2014). This email is confidential, and is for the intended recipient only. Access, disclosure, copying, distribution, or reliance on any of it by anyone outside the intended recipient organisation is prohibited and may be a criminal offence. Please delete if obtained in error and email confirmation to the sender. The views expressed in this email are not necessarily the views of the University of Tasmania, unless clearly intended otherwise.

1 0

Today! Bioinformatics!
by Michael Charleston 08 Sep '16

08 Sep '16

Dear all, Today I’d like to begin with adding to the list of topics we’d like to cover in these sessions. So far we have (mainly from me, I might add — hint, hint).. * CRISPR * Sequence alignment * Phylogenetic inference * Finding perfectly matching sequences * Gene finding * Mass Spec analysis * Phylogenetic networks * Scripting and workflows * More command-line-fu * Backing up data * Phylogenetic Trees * Mapping / Aligning sequence to reference genome * Population genetics analysis of SNP and other sequence data So I’ll talk today, once we do spend some time planning ahead, on how sequence alignment works. See you at 4pm! Michael Charleston Associate Professor in Bioinformatics School of Physical Sciences University of Tasmania AUSTRALIA phone: +61 3 6226 2444 University of Tasmania Electronic Communications Policy (December, 2014). This email is confidential, and is for the intended recipient only. Access, disclosure, copying, distribution, or reliance on any of it by anyone outside the intended recipient organisation is prohibited and may be a criminal offence. Please delete if obtained in error and email confirmation to the sender. The views expressed in this email are not necessarily the views of the University of Tasmania, unless clearly intended otherwise.

1 0

meeting topics
by Michael Charleston 05 Sep '16

05 Sep '16

So, While it’s a bit intimidating to ask “Hey, can you present something?” maybe it’s easier to answer the following question: What topics would you like to learn about in bioinformatics? E.g., * sequence alignment * mapping reads to a reference genome * metabolomics * proteomics * estimating trees * etc. I’ll put something up on the new UTAS blog: http://blogs.utas.edu.au/bioinformatics/2016/09/05/topics-to-discuss-in-our… Add your suggestions in the comments and I’ll see what I can do… Cheers Mike Michael Charleston Associate Professor in Bioinformatics School of Physical Sciences University of Tasmania AUSTRALIA phone: +61 3 6226 2444 University of Tasmania Electronic Communications Policy (December, 2014). This email is confidential, and is for the intended recipient only. Access, disclosure, copying, distribution, or reliance on any of it by anyone outside the intended recipient organisation is prohibited and may be a criminal offence. Please delete if obtained in error and email confirmation to the sender. The views expressed in this email are not necessarily the views of the University of Tasmania, unless clearly intended otherwise.

1 0

A gentle reminder
by Michael Charleston 05 Sep '16

05 Sep '16

Hi all, This is a gentle reminder, and a request on bended knee, about this week’s meeting on Thursday, 4pm, Maths & Physics building, lecture theatre 2. The reminder is that it’s happening! The request is, can anyone step up and present a paper, or talk about their work? Cheers Mike Michael Charleston Associate Professor in Bioinformatics School of Physical Sciences University of Tasmania AUSTRALIA phone: +61 3 6226 2444 University of Tasmania Electronic Communications Policy (December, 2014). This email is confidential, and is for the intended recipient only. Access, disclosure, copying, distribution, or reliance on any of it by anyone outside the intended recipient organisation is prohibited and may be a criminal offence. Please delete if obtained in error and email confirmation to the sender. The views expressed in this email are not necessarily the views of the University of Tasmania, unless clearly intended otherwise.

1 0

2024

2023

2022

2021

2020

2019

2018

2017

2016

bioinformatics-list September 2016